HABER ARAMA
SON DAKİKA HABERLER
ANKET
Yeni İnternet Sitemizi Beğendiniz mi?
Yeni İnternet Sitemizi Beğendiniz mi?
  • Gayet Güzel
  • Beğenmedim
  • Daha iyisi olabilirdi
  • Kullanışlı
HABER ARŞİVİ
Lütfen Bir Tarih Seçiniz
FINDIK BORSASI
14 Nisan 2021 Çarşamba
Fındık Fiyatı


PUAN DURUMU
NAMAZ VAKİTLERİ
Ünye Nöbetçi Eczaneleri
anadolujet telefon pegasus telefon thy iletişim

TURGAY GÜVEN

TURGAY GÜVEN

Canlıların Evrimi -1; Charles Darwin ve Evrim Teorisi ( 3 ) ( Devam)

3 Temmuz 2019 Çarşamba Saat: 08:52

           Aslında, insanoğlu, kendisi dışındaki  canlıları sınıflandırmaya, henüz teori aşamasında,   taa Yunanlı- Atina’lı Aristo’dan beri başlamıştı. İlk zamanlarda, Hayvanlar, basitçe,  Balıklar ( Pisces), İkiyaşayışlılar (karada-suda) ( Amphibia), Sürüngenler ( Reptilia), Kuşlar ( Aves) ve Memeliler ( Mammalia) olarak beş gurubta sınıflandırılıyorlardı.

           Ancak, bu yetersiz sınıflamadan  binlerce yıl sonra, 1735 yılında İsveçli Botanikçi Carl Linnaeus,  yüze yakın, bitki, hayvan ve mineral çeşidini, Systema Natura-Doğal Sistem adını verdiği cins, sıra ve sınıflara göre yerleştirdiği bir hiyerarşik düzen yayınlamış, daha sonraları geliştirerek 4 bin hayvan, 7 bin bitkiye çıkarmış, kodlamada ise Latince olarak bir cins ve bir  de tür adı ile,  Linnaeus kodlaması olarak anılan bir sistem yaratmıştı.

                Aynı sistem günümüz de de kullanılmaktadır. örneğin, Homo- insan, Sapiens- akıllı , Homo Sapiens- Akıllı insan şeklinde. Ayrıca, Homo Sapiens’in iki alt  türü ,  Homo Neanderthalensis ( Neanderthal insan) ve Homo Habilis  ( Yetenekli insan).

             Darwin’in Türlerin Kökeni’nde belirttiği gibi, doğal sınıflandırma sistemi, tamamıyle, tesadüfi, değişerek türeme üzerine kuruluydu ve  iki veya daha fazla türün arasında ki, gerçek yakınlığı gösteren ortak bir ata-kök mutlaka vardı. Bu tür ‘değişerek üreyen ve çoğalan  türeyiş modeli’, daha sonraları bu konu üzerinde araştırmalarda bulunan Alman Evrimci Ernst Haeckel tarafından ‘ Filogeni-filogenetik- ’olarak adlandırılmıştır. İlkel atalardan-köklerden daha gelişmiş alt soylara doğru yükselen ve en tepeye ‘insan’ın yerleştirildiği bu sistemle, evrimin, sürekli doğrusal bir çizgide ilerlediği düşüncesi yaratılmıştı.

                 Bu da yeterli olmayınca, yine bir Alman Evrimbilimci Wili Hennig tarafından değiştirilmiş, ‘yalnızca bir kök-ata ve onun  soyundan gelenlerin hepsinin birlikte yer aldığı , monofiletik gurup  olarak klad-sınıf  adı verilen bir sistematik  yada kladistik-sınıfsal dallanma’  yöntemi ile doğal bir sınıflandırma elde edilmeye çalışılmıştır. Biyolojik sınıflandırmada devrim yaratan bu sistem sayesinde,  hiç beklenmedik evrimsel ilişkiler ortaya çıkmıştır. En güzel  ve revaçta olan örnek ise, Krease dönemindeki göktaşı çarpmasıyla meydana gelen korkunç yok oluştan kurtulan bazı dinazor türlerinden, bugün, kuşlar sınıfının var olmuş olmasıdır.

             “Pekiyi hocam, bunları anladıkta, tüm bunların başlangıcı olduğunu söylediğiniz mutasyon nedir?” derseniz,  Mutasyon-değişinim, bir canlının genomu –genetik yapı birimi   içindeki DNA veya RNA diziliminde meydana gelen kalıcı değişmelerdir.                  

                 Mutasyona yol açan maddelere ( radyasyon, x ışınları kimyasal maddeler, ısı değişimleri vb) Mutajen, Mutasyon ile yenilenmiş-farklılaşmış  organizmalara Mutant denir.  Mutasyonlar genel olarak  sperm-yumurta- döllenmiş hücre germ-ilkel embriyo hattı mutasyonları ve  daha sonrasında, organların oluşumu sırasındaki,  somatik-gövdesel organ  mutasyonları  olarak ikiye ayrılır.      

           Genom, bir organizmanın kalıtım materyalinde bulunan genetik şifrelerin tümünü ifade eden bir kalıtım birimidir. Canlı yapısındaki bu genetik şifreyi taşıyan genler-genom  yapı, hücre çekirdeğinde bulunan kromozom iplikçiklerinin üzerine yerleşmiş DNA moleküllerinde saklıdır.

            Bir DNA molekülü, fosfat, şeker ve bir sıra şeklinde dizilmş  Adenin (A), Timin ( T ), Sitozin ( C) ile Guanin ( G ) yada Urasıl ( U ) adlı organik bazların bir araya gelmesiyle oluşmuş  bulunan   Nulkeotidlerden-genetik dizilimlerden  meydana gelir.

               Gerek yukarıda saydığımız bazı yabancı etkenler ve gerekse  hücrenin mayoz bölünmesi sırasındaki her hangi bir kromozom karışıklığı, yada  bazı kromozom parçalarının  herhangi  nedenle  yerlerinden koparak, başka kromozomlara yapışmaları sonucu genetik dizilimin farklılaşması gibi tesadüfi nedenlerle, bazen de yaşam şartlarının değiştiğini fark eden organizmanın, gelecek nesillerini yeni şartlara hazırlayabilmek için-her nasılsa- bilinçli yada bilinçsiz  olarak genom yapısını  değiştirmesiyle, yeni mutant  yavrular meydana gelir.

         Bir örnek verirsek, Normal dizilimi  AGTGCAATTGCGATTGCGAGCTC   şeklinde olan bir genetik materyele -genetik şifreye-genetik programa sahip  olan bir canlı türünde,  genetik yapı,     herhangi bir nedenle,  AGTG (x) AATTGCGATTGCGAGCTC  şeklinde  gibi  bir mutasyona-değişinime  uğradığında, kısacası, o upuzun zincirdeki bir tek C-Sitozin bazının kaybolmasıyla,  C’ nin yerine gelen herhangi bir  (X)  ile ki, burada  X, ya  tamamen boş (X=0) kalabilir  veya  X=A, G, T, U’ dan biri de  olabilir ,    bir  değişinim-mutasyon meydana geldiğinde,  oluşan yeni genetik yapı-yeni genetik şifre-yeni genetik program, canlının  tüm yaşam  organlarında  ve yaşamsal   fonksiyonlarında değişmelere yol açarak,  yeni bir  canlı organizmanın beden yapısı ortaya çıkabiliyor.                                                                                   Bunu en güzel günümüz virüslerinde gözlemliyoruz. Keratalar her yıl gen yapılarını değiştiriyorlar. Virüslerin genetik şifreleri çok sık değişmekte, her yıl yeni suşlardan –genetiği farklılaşmış guruplardan-yavrulardan   alınan numunelerle yeni aşı  üretimlerine mecbur kalınmaktadır.

            Bazen  canlı,  henüz   embriyo-fetüs veya yavru iken,   bazı genler tümüyle kaybolur, bu genlerin yeni yavruda yapacağı fonksiyonlar,  yani oluşumunu yöneteceği her neyse, dokular, organlar ve  her türlü özellikler yeni yavruda oluşmaz, -doğal seçilim-, genlerdeki eksiklik- yetersizlik  sonucu, bu şekilde,  peşpeşe fonksiyon eksikliğiyle  doğan yeni tür canlı, yaşamını devam ettiremez ve süreçten çekilir, türü  kaybolur.   Ancak, yine de, çoğu zaman, birçok ortak gen,  yeni yavru türünde de fonksiyon görmeyi sürdürür. Bu sayede,  bir tek hücreli canlı türünden,  bugüne kadar, milyonlarca canlı türü oluşabilmiştir.  

             Henüz genetiğin ve mutasyonun bilinmediği yüzyıllarda, Darwin, bu konuyu,  birbirleriyle binlerce mil uzaklıktaki Hawai adalarına yayılmış ve bir tür adalar arası  karantinaya uğramış İspinoz  kuşları arasındaki bedensel ayrıntılardan gözlemsel olarak  ispatlamış ise de, elbette ki günümüzde bu tür bir ispat çalışması biraz hafif kalabilir. Güncel bir örnek verirsek, günümüzde Avusturalya Kıtası diğer kıtalardan tamamen ayrı bir kıtadır. Örneğin  Sadece Avusturalya Kıtasına ait  türler içerisinde, en çok bilinen ve tanınan canlı türü olan Kangurular,  tarihi oldukça eski ve  özel bir istisna canlı türüdür.  Bu gün türü insanlar tarafından  yok edilmiş, Avusturalya köpeği de öyledir,  Dodo kuşu da..

         Bugünün insanı Homo Sapiensis Sapiensis,  değişen doğa koşulları ile besin ihtiyaçları nedeniyle,  günümüzden milyonlarca  yıl öncesine kadar uzanan bir tarihsel süreç içerisinde, doğduğu Doğu Afrika’dan çıkarak dünyanın tüm kıtalarına  yayılmış, bu günkü insan türleri bu şekilde oluşmuştur. Üç yüzbin  yıl kadar önce ise,  Hindistan-Endonezya- Avusturalya  güzergahı üzerinden, o zamanlar bir sıra yakın denizsel ve  karasal bağlantıları takip ederek Avusturalya kıtasına ulaşmış ve  Avusturalya yerlileri-ünlü Aborjinler oluşmuştur. Aborjinler’in  gen yapıları, günümüzde ki  bazı Hintli toplulukların gen yapılarıyla karşılaştırılmış, iskelet-kafatası-kemik yapısı vs. arkeolojik kalıntılarla tesbit edilebilen benzer özelliklerin yanında,  Aborjinlerle Hintlilerin genetik yapılarınında büyük ölçüde aynı olduğu, gen yapılarında, sadece bir tek ortak organik baz  farklılığı bulunduğu görülmüş ve Asya bağlantıları ortaya çıkartılmıştır. Bir tek ortak organik baz  farklılığı -değişimi ile oluşan Aborjinler, diğer insanlardan ayrı bir tür olarak varlıklarını günümüze kadar sürdürmüşlerdir.

           Sorunuzu anlıyorum. “Her ne kadar delil bulunup, ispata çalışılırsa çalışılsın, canlılara yeniden yaşatılıp,  yeniden tekrar edilemeyecek koskoca bir  teoriye neden inanalım ki ?” Diyorsunuz. “Kan guruplarınıza bakın.”                     

         Konu ile ilgili yazılarımız devam edecektir.

                   Saygılarımla. 


Bu haber toplam 898 defa okunmuştur

Yazı Yorumları ( 0 Adet)

Adınız
E-mail Adresiniz
Güvenlik Kodu Lütfen Resimdeki kodu yazınız
Bu Yazıya Yorum Yapılmamış.
İlk Yorumu Siz Yapmak İster misiniz?

Yazarın Diğer Yazıları